Review



prim 8.3.0 (538)  (GraphPad Software Inc)


Bioz Verified Symbol GraphPad Software Inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    GraphPad Software Inc prim 8.3.0 (538)
    Prim 8.3.0 (538), supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/prim 8.3.0 (538)/product/GraphPad Software Inc
    Average 90 stars, based on 1 article reviews
    prim 8.3.0 (538) - by Bioz Stars, 2026-05
    90/100 stars

    Images



    Similar Products

    90
    GraphPad Software Inc prim 8.3.0 (538)
    Prim 8.3.0 (538), supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/prim 8.3.0 (538)/product/GraphPad Software Inc
    Average 90 stars, based on 1 article reviews
    prim 8.3.0 (538) - by Bioz Stars, 2026-05
    90/100 stars
      Buy from Supplier

    90
    GraphPad Software Inc prim 8.3.0 (538
    KEY RESOURCES TABLE
    Prim 8.3.0 (538, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/prim 8.3.0 (538/product/GraphPad Software Inc
    Average 90 stars, based on 1 article reviews
    prim 8.3.0 (538 - by Bioz Stars, 2026-05
    90/100 stars
      Buy from Supplier

    Image Search Results


    Journal: Cell host & microbe

    Article Title: Fungal trans-kingdom dynamics linked to responsiveness to fecal microbiota transplantation (FMT) therapy in ulcerative colitis

    doi: 10.1016/j.chom.2020.03.006

    Figure Lengend Snippet: KEY RESOURCES TABLE

    Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Alkaline Phosphatase AffiniPure Goat Anti-Mouse IgG (H+L) Jackson Immuno Research Cat # 115-055-146 Bacterial and fungal Strains Candida albicans SC5314 ATCC MYA-2876 Biological samples Fecal samples from donor and UC FMT and placebo recipient Paramsothy et al., 2017 N/A Serum samples from UC FMT and placebo recipient Paramsothy et al., 2017 N/A Chemicals, Peptides, and Recombinant Proteins Fetal Bovine Serum Corning Cat# MT35016CV Lyticase from Arthrobacter luteus Sigma Cat# L2524 PNPP (p-nitrophenyl phosphate) Sigma Cat# 34045 Sabouraud dextrose broth VWR Cat# 89406-400 Critical Commercial Assays Quick-DNA Fungal/Bacterial Kit Zymo Research Cat# D6007 HighPrep™ PCR Clean-up System Magbiogenomics Cat# AC-60050 Kapa BiosystemsSupplier Diversity Partner HIFI HOTSTART READYMIX 500RXN Fisher Scientific Cat# KK2602 Nextera XT Index Kit v2 kit A Nextera XT Index Kit v2 Set B Illumina Cat# FC-131-200, FC-131-2002 QIAEX II Gel Extraction Kit Qiagen Cat# 20021 AccuPrime™ Taq DNA Polymerase, high fidelity Thermofisher Cat# 12346086 Oligonucleotides ITS1F: CTTGGTCATTTAGAGGAAGTAA, Li et al., 2018 N/A ITS2R: GCTGCGTTCTTCATCGATGC Li et al., 2018 NA Nextera Forward overhang: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-[locus-specific sequence] Illumina N/A Nextera Reverse overhang: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-[locus-specific sequence] Illumina NA Deposited Data 16S sequencing Paramsothy et al., 2017 European Nucleotide Archive, https://www.ebi.ac.uk/ena : PRJEB26472, PRJEB26474, PRJEB26473, PRJEB20349 and PRJEB26357 ITS Sequencing This paper NCBI BioProject repository, https://www.ncbi.nlm.nih.gov/bioproject/ : PRJNA590898 Software and Algorithms GraphPad Prim 8.3.0 (538) GraphPad Software N/A RStudio Desktop 1.2.1335 R Studio https://rstudio.com/ QIIME v1.6 QIIME www.qiime.org R version 3.5.0 (2018-04-23) R www.r-project.org Phyloseq v1.26.1 Phyloseq https://bioconductor.org/packages/release/bioc/html/phyloseq.html Vegan v2.5-5 Vegan https://cran.r-project.org/web/packages/vegan/ Estimation Stats DabestR v0.2.2 Ho et al, 2019 https://github.com/ACCLAB/dabestr Open in a separate window KEY RESOURCES TABLE

    Techniques: Recombinant, Gel Extraction, Sequencing, Software